View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19773_low_91 (Length: 231)
Name: NF19773_low_91
Description: NF19773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19773_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 8955206 - 8955010
Alignment:
| Q |
13 |
gaagcataggtataaataaaagattactcgtaaaaatgaggattccgtattccctttatgatctcatcattgtaggagtattctacccttgtaatgattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8955206 |
gaagcataggtataaataaaagattactcataaaaatgaggattccatattcccttcatgatcttatcattgtaggagtattctacccttgtaatgattt |
8955107 |
T |
 |
| Q |
113 |
cattcaaaaatccctgattgagagattctannnnnnnatatgcatgtattcatatgaaagtaattgaataaaatttgttattaattgatgttatgga |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8955106 |
cattcaaaaatccttgattgagagattctatttttttatatgcatgtattcctatgaaagtaattgaataaaatttgttattaattgatgttatgga |
8955010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University