View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_high_13 (Length: 414)
Name: NF19774_high_13
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 14 - 407
Target Start/End: Original strand, 31097942 - 31098334
Alignment:
| Q |
14 |
catcacccttaaccttgaatacatcgagtgattcagcattgattaactagtcattaatttctctctttcgtccatgacataacagaagcaggaagtctat |
113 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097942 |
catctcccttaaccttgaatacatcaagtgattcagcattgattaactggtcattaatttctctctttcgtccatgacataacagaagcaggaagtctat |
31098041 |
T |
|
| Q |
114 |
catttgcctcatatgatattgctcgatctttatgagtcacaattgaatctcagtatgtgaacacatcaccttctcatgttatgtccgtaaacaatcaact |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098042 |
catttgcctcatatgatattgctcgatctttgtgt-tcacaattgaatctcggtatgtgaacacatcaccttctcatgttatgtccgtaaacaatcaact |
31098140 |
T |
|
| Q |
214 |
tcaactctgcacaaagggagaaaaatcaatcaccgattacttgttgttctcatttaaaagtcttgcggatgaacttgttgttattgattgaaccctttta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098141 |
tcaactctgcacaaagggagaaaaatcaatcaccgattacttgttgttctcatttagaagtcttgcggatgaacttgttgttattgattgaaccctttta |
31098240 |
T |
|
| Q |
314 |
gatgatgattttacccttcatattctgaatggtctttgcacttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
407 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098241 |
gatgatgattttacccttcatattatgaatggtctttgcacttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
31098334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University