View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_high_19 (Length: 337)
Name: NF19774_high_19
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_high_19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 9 - 337
Target Start/End: Original strand, 46606271 - 46606600
Alignment:
| Q |
9 |
atatatataaaaaatcatagacataggttcgtttggaggtgtgtatgaggattcaattggctcattcgaggtgctttatttttgtctcattttttcaaat |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46606271 |
atatataaaaaaaatcatagacataggtttgtttggaggtgtgtatgaggattcaattggctcattcgaggtgctttatttttgtctcattttttcaaat |
46606370 |
T |
|
| Q |
109 |
gttaattcaatggtgacaagaaaattgtaatggagtgagaacatctaaggcaacttaaagacacatttggctttggtgaagagggatattatggggtaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46606371 |
gttaattcaatggtgacaagaaaattgtaatggagtgagaacatctaaggcaacttaaagacacatttggctttggtgaagagggatattatggggtaga |
46606470 |
T |
|
| Q |
209 |
aataacaacacaatcgactaacaaatagacacaatgaatggcctttgttattttttct-nnnnnnnnntgttggcatcttcacataggctaaaaaatgtg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46606471 |
aataacaacacaatcgactaacaaatagacacaatgaatggcctttgttattttttctaaaaaaaaaatgttggcatcttcacataggctaaaaaatgtg |
46606570 |
T |
|
| Q |
308 |
gtcgtcaaaatgaaggggattccaaaatac |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46606571 |
gtcgtcaaaatgaaggggattccaaaatac |
46606600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University