View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_high_44 (Length: 204)
Name: NF19774_high_44
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_high_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 7454965 - 7455155
Alignment:
| Q |
1 |
aaacacaacttaatatgtttcaactgatt----ataaaggtacannnnnnnn-ctttcaatttcaacaacaaataataatgcactactttcttttattta |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7454965 |
aaacacaacttaatatgtttcaactgattgtttataaaggtacatttttttttctttcaatttcaacaacaaataataatgcactactttcttttattta |
7455064 |
T |
|
| Q |
96 |
ttggagaaatgtttgccttatatatttttgttatagcttttggtcgtatcaatgcaaaaagacatggaagaaaaattcacaaccataggat |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7455065 |
ttggagaaatgtttgcctaatatatttttgttatagcttttggtcgtaccagtgcaaatagacatggaagaaaaattcacaaccataggat |
7455155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University