View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_low_19 (Length: 337)
Name: NF19774_low_19
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 15 - 327
Target Start/End: Original strand, 38342151 - 38342463
Alignment:
| Q |
15 |
tattttgaggtagaagaaaagataaagcttcgagttggttgagagagcagctgagaattataatttctttggcggatagcagctggaacaaagctgagct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38342151 |
tattttgaggtagaagaaaagataaagcttcgagttggttgagagagcagctgagaattataatttctttggcggatagcagctggaacaaagctgagct |
38342250 |
T |
 |
| Q |
115 |
ataatctagagttggtgctttgggcgtgaatgcatgctgatgttgtggcgtggcatatattctagtaggatgttggagattatctgggcacaaaattgga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38342251 |
ataatctagagttggtgctttgggcgtgaatgcgtgctgatgttgtggcgtggcatatattctagtaggatgttggagattatttgggcacaaaattgga |
38342350 |
T |
 |
| Q |
215 |
gaataattctgcatattgttttgatagagcccagtcacggagactgtgttgggataccaagaaaatggttgtggtaaataggtccaggtatgtaatgaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38342351 |
gaataattctgcatattgttttgatagagcccagtcacagagactgtgttgggataccaagaaaatggttgtggtaaataggtctgggtatgtaatgaat |
38342450 |
T |
 |
| Q |
315 |
tcaattgtctgtg |
327 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38342451 |
tcaattgtctgtg |
38342463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University