View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_low_32 (Length: 257)
Name: NF19774_low_32
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 423096 - 422868
Alignment:
| Q |
13 |
tatttcgtcgattctataagtttaaccattttttagatagtcttttannnnnnnncatcttaaattggttattgatgtttcattccgtttgcaccgttat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423096 |
tatttcgtcgattctataagtttaaccattttttaggtagtcttttattttttttcatcttaaattggttattgatgtttcattccgtttgcaccgttat |
422997 |
T |
 |
| Q |
113 |
tcctctatctcacttttaataatggtcgatacaatcataagcatatgatcattagggtctccatgcacagcnnnnnnntattcttaagaaagcaaccatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
422996 |
tcctctatctcacttttaataatggtcgatacaatcataagcatatgatcattagggtctccatgcacagcaaaaaaatattcttaagaaagcaaccatc |
422897 |
T |
 |
| Q |
213 |
aaacattataaatggtcgctatttccttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
422896 |
aaacattataaatggtcgctatttccttt |
422868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University