View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_low_33 (Length: 254)
Name: NF19774_low_33
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_low_33 |
 | |
|
| [»] scaffold2089 (1 HSPs) |
| | |
|
| [»] scaffold0445 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold2089 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: scaffold2089
Description:
Target: scaffold2089; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 116 - 239
Target Start/End: Original strand, 625 - 747
Alignment:
| Q |
116 |
gttgataacaaaaggtacatcatctcattcattttcttaccaaaccaaacttcatcattaatatcttgttgttgtgcttcctctaagtctatccatatta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
625 |
gttgataacaaaaggtacatcatctcatttattttcttaccaa-ccaaactttatcattactatctcgttgttgtgcttcctctaagtctatccatatta |
723 |
T |
|
| Q |
216 |
tatatgctctctcagttgatacct |
239 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
724 |
tatatgctcagtcagttgatacct |
747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 9076 - 9028
Alignment:
| Q |
188 |
tgtgcttcctctaagtctatccatattatatatgctctctcagttgata |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
9076 |
tgtgcttcctctaagtctatccatattatatatggtcagtcagttgata |
9028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 152
Target Start/End: Complemental strand, 6750109 - 6750040
Alignment:
| Q |
80 |
ggtgtgtggaaagacgcgtatatacgtcttcaatccgttgataacaaaaggtacatcatctcattcattttct |
152 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||| |||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
6750109 |
ggtgtgtagaaagacgcgtatata--tgttcaatcagttgat-acaaaaattacattatctcattcattttct |
6750040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 6950588 - 6950544
Alignment:
| Q |
108 |
ttcaatccgttgataacaaaaggtacatcatctcattcattttct |
152 |
Q |
| |
|
||||||| |||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
6950588 |
ttcaatcagttgatcaaaaaaggtacattatctcattcattttct |
6950544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University