View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_low_37 (Length: 242)
Name: NF19774_low_37
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 49001499 - 49001593
Alignment:
| Q |
19 |
ggcatatccttttatgctcttctcctttttgaaaaacaaaattagcttgattatgtgtatgcgcgtatacgtgtgtgggcatggacgtgcgtggaat |
115 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49001499 |
ggcatgtccttttatgctctcctcctttttgaaaaacaaaattagcttgattatgtgtat--gcgtatacgtgtgtgtgcatggacgtgcgtggaat |
49001593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 198 - 242
Target Start/End: Original strand, 49001643 - 49001687
Alignment:
| Q |
198 |
ttatagcttgctacatgtttagctttctatatttatttgtatgtt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49001643 |
ttatagcttgctacatgtttagctttctatatttatttgtatgtt |
49001687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University