View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19774_low_37 (Length: 242)

Name: NF19774_low_37
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19774_low_37
NF19774_low_37
[»] chr7 (2 HSPs)
chr7 (19-115)||(49001499-49001593)
chr7 (198-242)||(49001643-49001687)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 49001499 - 49001593
Alignment:
19 ggcatatccttttatgctcttctcctttttgaaaaacaaaattagcttgattatgtgtatgcgcgtatacgtgtgtgggcatggacgtgcgtggaat 115  Q
    ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||||||||||||    
49001499 ggcatgtccttttatgctctcctcctttttgaaaaacaaaattagcttgattatgtgtat--gcgtatacgtgtgtgtgcatggacgtgcgtggaat 49001593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 198 - 242
Target Start/End: Original strand, 49001643 - 49001687
Alignment:
198 ttatagcttgctacatgtttagctttctatatttatttgtatgtt 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
49001643 ttatagcttgctacatgtttagctttctatatttatttgtatgtt 49001687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University