View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19774_low_44 (Length: 229)
Name: NF19774_low_44
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19774_low_44 |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 33674452 - 33674529
Alignment:
| Q |
19 |
gtagcatcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggcagctatggcggtgg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33674452 |
gtagcatcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggcagctatggcggtgg |
33674529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 21 - 82
Target Start/End: Original strand, 33692871 - 33692932
Alignment:
| Q |
21 |
agcatcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggc |
82 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
33692871 |
agcatcaacatcattgaggatttcaagaaccttttgaatggtggaaacatcgttgcggtggc |
33692932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 23 - 82
Target Start/End: Original strand, 33685646 - 33685705
Alignment:
| Q |
23 |
catcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggc |
82 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
33685646 |
catcaatatcattgaggatttctagaaccttttgaatggttgaaacatcgttgtggtggc |
33685705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 33663857 - 33663915
Alignment:
| Q |
24 |
atcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggc |
82 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33663857 |
atcaacatcattaagaatttctagaaccttttgaatggtggaaacatcgttgtggtggc |
33663915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 21 - 82
Target Start/End: Complemental strand, 86907 - 86846
Alignment:
| Q |
21 |
agcatcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggc |
82 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
86907 |
agcatcaacttcattaaggatttctagaaccttttgaatggtggaaacatcgttgtggtggc |
86846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 103576 - 103512
Alignment:
| Q |
21 |
agcatcaacatcattgaggatttctagaaccttttgcatggtggaaacatcgttgtggtggcagc |
85 |
Q |
| |
|
||||||||| | |||||| ||||||| ||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
103576 |
agcatcaactttattgagaatttctaaaaccttttgaatggtggaaacatcatcgtggtggcagc |
103512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University