View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19774_low_48 (Length: 204)

Name: NF19774_low_48
Description: NF19774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19774_low_48
NF19774_low_48
[»] chr6 (1 HSPs)
chr6 (1-186)||(7454965-7455155)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 7454965 - 7455155
Alignment:
1 aaacacaacttaatatgtttcaactgatt----ataaaggtacannnnnnnn-ctttcaatttcaacaacaaataataatgcactactttcttttattta 95  Q
    |||||||||||||||||||||||||||||    |||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||    
7454965 aaacacaacttaatatgtttcaactgattgtttataaaggtacatttttttttctttcaatttcaacaacaaataataatgcactactttcttttattta 7455064  T
96 ttggagaaatgtttgccttatatatttttgttatagcttttggtcgtatcaatgcaaaaagacatggaagaaaaattcacaaccataggat 186  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||    
7455065 ttggagaaatgtttgcctaatatatttttgttatagcttttggtcgtaccagtgcaaatagacatggaagaaaaattcacaaccataggat 7455155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University