View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19775_low_2 (Length: 520)
Name: NF19775_low_2
Description: NF19775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19775_low_2 |
 |  |
|
| [»] scaffold0590 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 20)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 83 - 503
Target Start/End: Complemental strand, 48064698 - 48064240
Alignment:
| Q |
83 |
gagttaatgaacggttacttaccaactgcaatgtttgacggaaaatggatatataatggacggtgcataagttgaagggttgtttgtttg---------- |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48064698 |
gagttaatgaacggttacttaccaactgcaatgtttgacggaaaatggatatatagtggacggtgcataagttgaagggttgtttgtttgtttgtttgtt |
48064599 |
T |
 |
| Q |
173 |
------ataaatcatacaatatgaaggtcggtgcagcagagctatgcattttgttgttcaccacatcttgccttcttcacttttcatcagagctacaaca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48064598 |
tgtttgataaatcatacaatatgaaggtcggtgcagcagagctatgcattttgttgttcaccacatcttgccttcttcacttttcatcagagctacaaca |
48064499 |
T |
 |
| Q |
267 |
ttctatgccttatgattattctgctactactcaggcaatgccactaccttatctcttctttattactagt-ttttatataccgacaaaaaatctgagtgc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
48064498 |
ttctatgccttatgattattctgctactactcaggcaatgccacttccttatctcttctttattactagttttttatataccgacaaaaaatcttagtgc |
48064399 |
T |
 |
| Q |
366 |
ataaacacttttgacactgattctgagaatttattatcacagcttatcaattgtttataagttcttt---------------------taacttatacaa |
444 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48064398 |
ataaacacttgtgacactgattctgagaatttatgatcacagcttatcaattgtttataagttctttttaacttatgaaatcaacttataacttatacaa |
48064299 |
T |
 |
| Q |
445 |
aaatagttttactttattttatcttttgctatagaaatagtttctacattaggactaat |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48064298 |
aaatagttttactttattttatcttttgctatagaaattgtttctacattaggactaat |
48064240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 7028290 - 7028233
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||| | || ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7028290 |
cttatacaaaaacaacttaactttattttatcttttgctatagaaatagtttatacat |
7028233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 48069864 - 48069813
Alignment:
| Q |
268 |
tctatgccttatgattattctgctactactcaggcaatgccactaccttatc |
319 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |||||| ||||| |
|
|
| T |
48069864 |
tctatgccttatgattattctgctacgactgaggcaatgtcactactttatc |
48069813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 437 - 483
Target Start/End: Original strand, 15565905 - 15565951
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| | |||||| |
|
|
| T |
15565905 |
ttatacaaaaatagtttgactttattttatcttttgctttggaaata |
15565951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 438 - 487
Target Start/End: Original strand, 24915125 - 24915174
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
24915125 |
tatacaaaaacaatttaactttattttatcttctgctatagaaatagttt |
24915174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 9572180 - 9572228
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9572180 |
cttatacaaaagcaatttaactttattttatcttttgctatagaaatag |
9572228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 484
Target Start/End: Complemental strand, 38578525 - 38578477
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
38578525 |
cttatacaaaaataatttaactttatgttatcttttgttatagaaatag |
38578477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 48102359 - 48102308
Alignment:
| Q |
268 |
tctatgccttatgattattctgctactactcaggcaatgccactaccttatc |
319 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| |||||| ||||| |
|
|
| T |
48102359 |
tctatgccttatgattattctgctacgaccgaggcaatgtcactactttatc |
48102308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 433 - 484
Target Start/End: Complemental strand, 51190862 - 51190811
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||||| || |||||| |
|
|
| T |
51190862 |
taacttatacaaaaacaatttaactttattttatcttttgctttacaaatag |
51190811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 435 - 481
Target Start/End: Original strand, 30815706 - 30815752
Alignment:
| Q |
435 |
acttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
30815706 |
acttatatgaaaatagtttaactttattttatcttttgttatagaaa |
30815752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 443 - 493
Target Start/End: Original strand, 33339499 - 33339549
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||||| || ||||| |
|
|
| T |
33339499 |
aaaaatagtttaacttcattttatcttttggtatagaaatagcttatacat |
33339549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 460 - 493
Target Start/End: Complemental strand, 6659677 - 6659644
Alignment:
| Q |
460 |
attttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
6659677 |
attttatcttttgctatagaaatagtttatacat |
6659644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 483
Target Start/End: Complemental strand, 13809994 - 13809949
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
13809994 |
tatacaaaaacaatttaactttattttatcttttgctaaagaaata |
13809949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 451 - 483
Target Start/End: Original strand, 4777372 - 4777404
Alignment:
| Q |
451 |
ttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
4777372 |
ttttattttattttatcttttgctatagaaata |
4777404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 482
Target Start/End: Complemental strand, 15477574 - 15477530
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaat |
482 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||| |||||||||| |
|
|
| T |
15477574 |
tatacaaaaacaatttaactttattttatcttttactatagaaat |
15477530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 493
Target Start/End: Original strand, 36151574 - 36151634
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||| |||| | ||| |||||||||||||||||| ||| ||||||| || ||||| |
|
|
| T |
36151574 |
taacttatacgaaaacaatttgactttattttatcttttgttattgaaatagcttatacat |
36151634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 37842440 - 37842484
Alignment:
| Q |
449 |
agttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| || ||||| |
|
|
| T |
37842440 |
agtttaactttatttcatcttttgctatagaaatagcttatacat |
37842484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 480
Target Start/End: Original strand, 39658552 - 39658596
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaa |
480 |
Q |
| |
|
||||||| |||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
39658552 |
cttatacgaaaataatttaactttactttatcttttgctatagaa |
39658596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 486
Target Start/End: Original strand, 41184724 - 41184772
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatagtt |
486 |
Q |
| |
|
|||||||||| | ||| || |||||||||||||||||||| |||||||| |
|
|
| T |
41184724 |
tatacaaaaacaatttaacattattttatcttttgctataaaaatagtt |
41184772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 42351986 - 42352026
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
42351986 |
aaaatagtttgactttattttaacttttgttatagaaatag |
42352026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 434 - 493
Target Start/End: Original strand, 37063144 - 37063203
Alignment:
| Q |
434 |
aacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
37063144 |
aacttatatgaaaatagtttgactttattttatcttttgttatagaaatagtttatacat |
37063203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 483
Target Start/End: Original strand, 29117002 - 29117049
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
29117002 |
cttatacgaaaacagtttgactttattttatcttttgttatagaaata |
29117049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 483
Target Start/End: Original strand, 35135742 - 35135781
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
35135742 |
aaaatagtttgactttattttatcttttgttatagaaata |
35135781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 4014515 - 4014553
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
4014515 |
actttattttatcttttgctatagaaatagcttatacat |
4014553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 445 - 487
Target Start/End: Complemental strand, 35960403 - 35960361
Alignment:
| Q |
445 |
aaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
35960403 |
aaatagtttgactttattttatcttttattatagaaatagttt |
35960361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Original strand, 7096207 - 7096256
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| |||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
7096207 |
aaaatggtttgactttattttatcttttgttatagaaatagcttatacat |
7096256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 452 - 493
Target Start/End: Original strand, 12407749 - 12407790
Alignment:
| Q |
452 |
tttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
12407749 |
tttactttattttatcttttgttatagaaatagcttatacat |
12407790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 12425569 - 12425512
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||| |||| | ||| ||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
12425569 |
cttatacgaaaacaatttaactttattttatcttttactatataaatagtttatacat |
12425512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 485
Target Start/End: Original strand, 28586846 - 28586887
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagt |
485 |
Q |
| |
|
|||| ||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
28586846 |
aaaacagtttgactttattttatcttttgttatagaaatagt |
28586887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 481
Target Start/End: Original strand, 32969189 - 32969234
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
32969189 |
cttatataaaaataatttgactttattttatcttttgttatagaaa |
32969234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 428 - 481
Target Start/End: Original strand, 40048344 - 40048397
Alignment:
| Q |
428 |
tcttttaacttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
||||||||||| ||| |||||| | | |||||||||||||||||| |||||||| |
|
|
| T |
40048344 |
tcttttaacttttacgaaaataatataactttattttatcttttgttatagaaa |
40048397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 484
Target Start/End: Original strand, 42569071 - 42569100
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42569071 |
actttattttatcttttgctatagaaatag |
42569100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Complemental strand, 465952 - 465904
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||| |||||||||| |
|
|
| T |
465952 |
cttatacaaaaacaatttaactttattttatcttttgtcatagaaatag |
465904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 3566390 - 3566438
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||| | ||||||||||| |
|
|
| T |
3566390 |
cttatacaaaaataatttaactttattttctctttgggtatagaaatag |
3566438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Complemental strand, 7853637 - 7853605
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
7853637 |
actttattttatcttttgttatagaaatagttt |
7853605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Complemental strand, 10303780 - 10303748
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
10303780 |
actttattttatcttttgttatagaaatagttt |
10303748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Complemental strand, 14295496 - 14295456
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
14295496 |
aaaacagtttgactttattttatcttttgttatagaaatag |
14295456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 29935421 - 29935469
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
29935421 |
cttatacaaaaataatttaactttattttactttttgctaaagaaatag |
29935469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 35095874 - 35095906
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
35095874 |
actttattttatcttttgttatagaaatagttt |
35095906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 437 - 493
Target Start/End: Original strand, 37112331 - 37112387
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||||| | ||| ||||| |||||||||||||| ||||||||| || ||||| |
|
|
| T |
37112331 |
ttatacaaaaacaatttaactttgttttatcttttgctgtagaaatagcttatacat |
37112387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 452 - 484
Target Start/End: Complemental strand, 39594790 - 39594758
Alignment:
| Q |
452 |
tttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
39594790 |
tttactttattttatctttttctatagaaatag |
39594758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 437 - 493
Target Start/End: Complemental strand, 26215493 - 26215437
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
26215493 |
ttatacgaaaatagtttaactttattttatcttttgttatagaaatagcttatacat |
26215437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 433 - 482
Target Start/End: Original strand, 30600418 - 30600467
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaat |
482 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
30600418 |
taacttatacaaaaatagttcgactttattttagtttttgctatagaaat |
30600467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 39392746 - 39392790
Alignment:
| Q |
449 |
agttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39392746 |
agtttgactttattttatcttttgttatagaaatagtttatacat |
39392790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 434 - 481
Target Start/End: Complemental strand, 2100805 - 2100758
Alignment:
| Q |
434 |
aacttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
2100805 |
aacttatatgaaaatattttgactttattttatcttttgctatagaaa |
2100758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 483
Target Start/End: Complemental strand, 26820189 - 26820150
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
26820189 |
aaaatagtttgactttattttatcttttgttatagaaata |
26820150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 436 - 482
Target Start/End: Original strand, 3537103 - 3537149
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaat |
482 |
Q |
| |
|
||||||| |||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
3537103 |
cttatacgaaaacaatttgactttattttatcttttgctatagaaat |
3537149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 445 - 483
Target Start/End: Complemental strand, 8799394 - 8799356
Alignment:
| Q |
445 |
aaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
8799394 |
aaatagtttgactttattttatcttttgttatagaaata |
8799356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 455 - 493
Target Start/End: Complemental strand, 14482181 - 14482143
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
14482181 |
actttattttatcttttgttatagaaatagtttatacat |
14482143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 443 - 493
Target Start/End: Original strand, 25881549 - 25881599
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
25881549 |
aaaattagtttgactttattttatgttttgctataaaaatagtttatacat |
25881599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 433 - 487
Target Start/End: Original strand, 29168961 - 29169015
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||| |||||||||||| ||| | || |||||||||||||||||||||| ||||| |
|
|
| T |
29168961 |
taacatatacaaaaataatttaatttaattttatcttttgctatagaaacagttt |
29169015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 451 - 493
Target Start/End: Complemental strand, 42597384 - 42597342
Alignment:
| Q |
451 |
ttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
42597384 |
ttttactttattttatcttttgttatagaaatagcttatacat |
42597342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 487
Target Start/End: Original strand, 10758330 - 10758379
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||| | ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
10758330 |
tatacaaaaacaatttaactttattttatgatttgctatagaaatagttt |
10758379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 487
Target Start/End: Complemental strand, 29205804 - 29205755
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||| | ||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
29205804 |
tatacaaaaacaatttaacttcattttatctttttctatagaaatagttt |
29205755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 2364545 - 2364593
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||| | ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2364545 |
cttatacaaaagaaatttgactttattttatcttttgctataaaaatag |
2364593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 435 - 487
Target Start/End: Complemental strand, 2606018 - 2605966
Alignment:
| Q |
435 |
acttatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||| | ||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
2606018 |
acttatatagaaatagtttgacttaattttatcttttgtcatagaaatagttt |
2605966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 27728101 - 27728141
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
27728101 |
aaaatagtttgactttattttatctttttttatagaaatag |
27728141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 443 - 483
Target Start/End: Complemental strand, 38561717 - 38561677
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
38561717 |
aaaaatagtttgactttattttatcttttgttatataaata |
38561677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 443 - 483
Target Start/End: Original strand, 40728497 - 40728537
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
40728497 |
aaaaacagtttgactttattttatcttttgttatagaaata |
40728537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 437 - 493
Target Start/End: Complemental strand, 13866886 - 13866830
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| ||||| ||||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
13866886 |
ttatataaaaacagtttgacttaattttatcttttgctatagaaatagtttatacat |
13866830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 437 - 493
Target Start/End: Complemental strand, 3102690 - 3102634
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||||| |||||| || ||||| |
|
|
| T |
3102690 |
ttatataaaaatagtttgactttattttatattttgctataaaaatagcttatacat |
3102634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 17952781 - 17952821
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17952781 |
aaaatagtttgactttattttatcttttgttatagaaatag |
17952821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 444 - 483
Target Start/End: Original strand, 1939412 - 1939451
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
1939412 |
aaaatagtttcactttattttatcttttgttatagaaata |
1939451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 484
Target Start/End: Complemental strand, 4026814 - 4026767
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4026814 |
ttatgcaaaaataatttaactttattttatcttttgctataaaaatag |
4026767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 433 - 487
Target Start/End: Complemental strand, 33192194 - 33192140
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
33192194 |
taacttatatgaaaacagtttgactttattttatcttatgttatagaaatagttt |
33192140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 483
Target Start/End: Complemental strand, 3611222 - 3611177
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||| | ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3611222 |
tatacaaaaacaatttaactttattttaccttttgctatagaaata |
3611177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 5133770 - 5133713
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
5133770 |
cttatataaaaacagtttatctttattttatcttttgttatagaaatagcttatacat |
5133713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 484
Target Start/End: Original strand, 9878761 - 9878802
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
9878761 |
aaaaatagtttgagtttattttatcttttgttatagaaatag |
9878802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 484
Target Start/End: Original strand, 26143732 - 26143761
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26143732 |
actttattttatcttttgctatagaaatag |
26143761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 34339121 - 34339064
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||| |||| ||| | |||||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
34339121 |
cttatacgaaaacagtctgactttattttatctttagctatagaaaaagtttatacat |
34339064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Complemental strand, 37034034 - 37033985
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
37034034 |
aaaatcgtttgactttattttatctttttttatagaaatagtttatacat |
37033985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 42457946 - 42457889
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||| ||||||| | ||| ||||||||||||||||| |||||||||||| || ||||| |
|
|
| T |
42457946 |
cttaaacaaaaacaatttaactttattttatcttttactatagaaatagattatacat |
42457889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 483
Target Start/End: Complemental strand, 3932329 - 3932301
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3932329 |
actttattttatcttttgctatagaaata |
3932301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 31740039 - 31740079
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
31740039 |
aaaatagtttgactttattttatctttagttatagaaatag |
31740079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 437 - 493
Target Start/End: Complemental strand, 32694209 - 32694153
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| ||||||||| | | |||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
32694209 |
ttatataaaaatagtctgattttattttatcttttgatatagaaatagcttatacat |
32694153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 480
Target Start/End: Original strand, 36114595 - 36114639
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaa |
480 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||| ||||||| |
|
|
| T |
36114595 |
cttatacaaaaacaatttaactttattttatcttttgttatagaa |
36114639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 481
Target Start/End: Original strand, 36863694 - 36863742
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||| ||| ||||| |
|
|
| T |
36863694 |
taacttatataaaaattgtttgactttattttatcttttactagagaaa |
36863742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 472
Target Start/End: Original strand, 37292427 - 37292455
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttg |
472 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37292427 |
aaaatagttttactttattttatcttttg |
37292455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 440 - 484
Target Start/End: Original strand, 44438915 - 44438959
Alignment:
| Q |
440 |
tacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
44438915 |
tacaaaaacagtttgactttattttatcttttgctacggaaatag |
44438959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 20)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 433 - 484
Target Start/End: Complemental strand, 17884069 - 17884018
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17884069 |
taacttatacaaaaacaatttaactttattttatcttttgttatagaaatag |
17884018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 440 - 493
Target Start/End: Complemental strand, 3155597 - 3155544
Alignment:
| Q |
440 |
tacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
3155597 |
tacaaaaacaatttaactttattttatcttttgctatagaaatagcttatacat |
3155544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 444 - 485
Target Start/End: Original strand, 20936082 - 20936123
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagt |
485 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
20936082 |
aaaatagtttgactttattttatcttttgttatagaaatagt |
20936123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 429 - 484
Target Start/End: Complemental strand, 29912953 - 29912899
Alignment:
| Q |
429 |
cttttaacttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
29912953 |
cttttaacatatacaaaacaa-ttttactttattttattttttgctatagaaatag |
29912899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 483
Target Start/End: Complemental strand, 47800628 - 47800581
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||| |||||||||| |
|
|
| T |
47800628 |
cttatacaaaaacattttaactttattttatcttttgttatagaaata |
47800581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 444 - 486
Target Start/End: Complemental strand, 4071872 - 4071830
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtt |
486 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4071872 |
aaaataatttgactttattttatcttttgttatagaaatagtt |
4071830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 445 - 487
Target Start/End: Complemental strand, 27406040 - 27405998
Alignment:
| Q |
445 |
aaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
27406040 |
aaatagtttgcctttattttatcttttactatagaaatagttt |
27405998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 433 - 487
Target Start/End: Original strand, 46013369 - 46013423
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||| ||||| ||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
46013369 |
taacttatataaaaacagtttgactttattttatcttttgttccagaaatagttt |
46013423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 21953271 - 21953214
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| ||||| ||||| |||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
21953271 |
cttatataaaaagagtttgactttattttcccttttgttatagaaatagtttatacat |
21953214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Original strand, 28581990 - 28582038
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||||||| ||||| |
|
|
| T |
28581990 |
aaaatagtttgactttattttatcttttgcta-aaaaatagtttatacat |
28582038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Original strand, 30338672 - 30338721
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||| ||||| |||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
30338672 |
aaaacagtttaactttattctatcttttgttatagaaatagtttatacat |
30338721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Complemental strand, 47970308 - 47970259
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||||||||| || ||||| |
|
|
| T |
47970308 |
aaaatagtttgacttcattttatcttttgttatagaaatagcttatacat |
47970259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Complemental strand, 2703030 - 2702990
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2703030 |
aaaaaagtttaactttattttatcttttgctatataaatag |
2702990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 443 - 487
Target Start/End: Complemental strand, 3662339 - 3662295
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
3662339 |
aaaaacagtttgactttattttatcttttgttataggaatagttt |
3662295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 493
Target Start/End: Complemental strand, 7601760 - 7601700
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||| |||||||||| | ||| ||||||||||||| |||||||||| ||||| || ||||| |
|
|
| T |
7601760 |
taacatatacaaaaacaatttaactttattttatcctttgctataggaatagcttatacat |
7601700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 427 - 483
Target Start/End: Complemental strand, 27623642 - 27623586
Alignment:
| Q |
427 |
ttcttttaacttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||| || |||||| |||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
27623642 |
ttcttatagcttatattaaaatagtttgactttattttatcttttgttatacaaata |
27623586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 451 - 483
Target Start/End: Complemental strand, 30024683 - 30024651
Alignment:
| Q |
451 |
ttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
30024683 |
ttttactttattttatcttttgttatagaaata |
30024651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Complemental strand, 32724109 - 32724069
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
32724109 |
aaaatagtttgactttattttatcttttgtaatagaaatag |
32724069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 51044544 - 51044588
Alignment:
| Q |
449 |
agttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
51044544 |
agtttgactttattttatcttttgttatagaaatagcttatacat |
51044588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 492
Target Start/End: Original strand, 54325117 - 54325165
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctaca |
492 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
54325117 |
aaaacagtttgactttattttatcttttgtaatagaaatagtttataca |
54325165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 438 - 484
Target Start/End: Original strand, 30956700 - 30956746
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30956700 |
tatacaaaaacaatttaactttattttatcttttgctatagaaatag |
30956746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 438 - 484
Target Start/End: Original strand, 30972512 - 30972558
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30972512 |
tatacaaaaacaatttaactttattttatcttttgctatagaaatag |
30972558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 483
Target Start/End: Original strand, 23952178 - 23952225
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||| |||||||||| |
|
|
| T |
23952178 |
cttatacaaaaatactttgacttaattttatcttttgttatagaaata |
23952225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 487
Target Start/End: Original strand, 25447316 - 25447367
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
|||||||||||| | ||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
25447316 |
cttatacaaaaacaatttaagtttattttatcttttactatagaaatagttt |
25447367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 443 - 493
Target Start/End: Original strand, 24268234 - 24268284
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| ||||| |||| |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
24268234 |
aaaaaaagtttgacttgattttaacttttgctatagaaatagtttatacat |
24268284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 443 - 493
Target Start/End: Complemental strand, 33883019 - 33882969
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||| ||| |||||||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
33883019 |
aaaaataatttcactttattttatcttttgttatagaaataatttatacat |
33882969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 438 - 484
Target Start/End: Original strand, 35959530 - 35959576
Alignment:
| Q |
438 |
tatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
35959530 |
tatacaaaaataatttaactttattttatccttttctatagaaatag |
35959576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 437 - 483
Target Start/End: Complemental strand, 54775125 - 54775079
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
54775125 |
ttatataaaaatggtttgactttattttatcttttgttatagaaata |
54775079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Complemental strand, 1395661 - 1395612
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
1395661 |
aaaataatttgactttattttatcttttgttatagaaatagcttatacat |
1395612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 496
Target Start/End: Complemental strand, 1816581 - 1816520
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctat-agaaatagtttctacattag |
496 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| ||| | ||||||||| |||||||| |
|
|
| T |
1816581 |
cttatacaaaaacagtttgactttattttatcttttattataaaaaatagtttatacattag |
1816520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 428 - 493
Target Start/End: Original strand, 33307516 - 33307581
Alignment:
| Q |
428 |
tcttttaacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||| ||||||||| ||||||||||| | || |||||||||||||| |||||||| ||| ||||| |
|
|
| T |
33307516 |
tcttataacttatataaaaatagtttggcattgttttatcttttgctctagaaataatttatacat |
33307581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 451 - 484
Target Start/End: Original strand, 36783421 - 36783454
Alignment:
| Q |
451 |
ttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
36783421 |
ttttactttattttatcttttggtatagaaatag |
36783454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 434 - 483
Target Start/End: Original strand, 53736183 - 53736232
Alignment:
| Q |
434 |
aacttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||| |||||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
53736183 |
aacttatatgaaaatagtttgacattattttatcttttgttatagaaata |
53736232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Original strand, 33405258 - 33405290
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
33405258 |
actttattttaccttttgctatagaaatagttt |
33405290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 456 - 484
Target Start/End: Complemental strand, 37689211 - 37689183
Alignment:
| Q |
456 |
ctttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37689211 |
ctttattttatcttttgctatagaaatag |
37689183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Complemental strand, 38462271 - 38462231
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
38462271 |
aaaacagtttgactttattttatcttttggtatagaaatag |
38462231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 44061095 - 44061143
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||| ||||| | ||| || ||||||||||||||||||||||||||| |
|
|
| T |
44061095 |
cttatagaaaaacaatttaaccttattttatcttttgctatagaaatag |
44061143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 49586996 - 49587036
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
49586996 |
aaaacagtttgactttattttatcttttgttatagaaatag |
49587036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 16)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 40689066 - 40689106
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
40689066 |
aaaataatttaactttattttatcttttgctatagaaatag |
40689106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 484
Target Start/End: Complemental strand, 42656513 - 42656465
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
42656513 |
cttatacaaaaatgatttgactttattttatcttttgttatagaaatag |
42656465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 483
Target Start/End: Original strand, 34083597 - 34083644
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
|||||||| ||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
34083597 |
cttatacacaaacaatttaactttattttatcttttgctatagaaata |
34083644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 434 - 477
Target Start/End: Complemental strand, 46531533 - 46531490
Alignment:
| Q |
434 |
aacttatacaaaaatagttttactttattttatcttttgctata |
477 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
46531533 |
aacttatataaaaacagtttgactttattttatcttttgctata |
46531490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 436 - 482
Target Start/End: Original strand, 18749882 - 18749928
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaat |
482 |
Q |
| |
|
|||||| ||||||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
18749882 |
cttatataaaaatagtttgactttactttatcttttgttatagaaat |
18749928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 440 - 493
Target Start/End: Original strand, 35808980 - 35809033
Alignment:
| Q |
440 |
tacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||| ||||||||||| || ||||| |
|
|
| T |
35808980 |
tacaaaattagtttgactatattttatcttttgttatagaaatagcttatacat |
35809033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 492
Target Start/End: Original strand, 37832230 - 37832267
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagtttctaca |
492 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
37832230 |
actttattttatattttgctatagaaatagtttataca |
37832267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 443 - 484
Target Start/End: Complemental strand, 47004078 - 47004037
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
47004078 |
aaaaatagtttgactttattttatctattgttatagaaatag |
47004037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 436 - 493
Target Start/End: Complemental strand, 49060538 - 49060481
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||| ||||| ||||||||||| || ||||| |
|
|
| T |
49060538 |
cttatataaaaataatttgactttattttattttttgttatagaaatagcttatacat |
49060481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 450 - 486
Target Start/End: Complemental strand, 2999175 - 2999139
Alignment:
| Q |
450 |
gttttactttattttatcttttgctatagaaatagtt |
486 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2999175 |
gtttgactttattttatcttttgttatagaaatagtt |
2999139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 437 - 493
Target Start/End: Original strand, 27626197 - 27626253
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||| || |||||||| ||||||||||| |||||| ||||||||||| || ||||| |
|
|
| T |
27626197 |
ttatataataatagtttgactttattttagcttttgatatagaaatagcttatacat |
27626253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 493
Target Start/End: Original strand, 28613603 - 28613663
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||||||||| | ||| ||||| |||||||||||| |||| |||||| || ||||| |
|
|
| T |
28613603 |
taacttatacaaaaacaatttaactttgttttatcttttgttataaaaatagcttatacat |
28613663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 30160970 - 30161010
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
30160970 |
aaaacagtttgactttattttatcttttgccatagaaatag |
30161010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 437 - 493
Target Start/End: Complemental strand, 30496701 - 30496645
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||| |||| | ||| |||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
30496701 |
ttatacgaaaacaatttgactttattttatattttgttatagaaatagtttatacat |
30496645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 493
Target Start/End: Complemental strand, 31341195 - 31341135
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||||||| |||| |||||| || ||||| |
|
|
| T |
31341195 |
taacttatataaaaccagtttgactttattttatcttttgttatacaaatagcttatacat |
31341135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 487
Target Start/End: Complemental strand, 45004745 - 45004713
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
45004745 |
actttattttatcttttgctataaaaatagttt |
45004713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000003; HSPs: 13)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 444 - 484
Target Start/End: Complemental strand, 1402986 - 1402946
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
1402986 |
aaaatagtttaactttattttatcttttgttatagaaatag |
1402946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 436 - 472
Target Start/End: Complemental strand, 4420643 - 4420607
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttg |
472 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4420643 |
cttatacaaaaatagtttgactttattttatcttttg |
4420607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 503
Target Start/End: Complemental strand, 507218 - 507151
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctacattaggactaat |
503 |
Q |
| |
|
|||||||||||| | | | |||||||||||||||||| |||||||||| ||| ||||| || |||||| |
|
|
| T |
507218 |
cttatacaaaaacaatctaactttattttatcttttgttatagaaataatttatacataagcactaat |
507151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 484
Target Start/End: Complemental strand, 2735066 - 2735019
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| |||||| |||| |
|
|
| T |
2735066 |
ttatacaaaaataatttaactttattttatcttttgttatagacatag |
2735019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 437 - 483
Target Start/End: Complemental strand, 5328971 - 5328925
Alignment:
| Q |
437 |
ttatacaaaaatagttttactttattttatcttttgctatagaaata |
483 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
5328971 |
ttatataaaaatggtttgactttattttatcttttgttatagaaata |
5328925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 434 - 492
Target Start/End: Original strand, 8349734 - 8349792
Alignment:
| Q |
434 |
aacttatacaaaaatagttttactttattttatcttttgctatagaaatagtttctaca |
492 |
Q |
| |
|
|||||||| ||||| | ||| |||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
8349734 |
aacttatataaaaacaatttaactttattttatcttttgttagagaaatagtttataca |
8349792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 29274320 - 29274358
Alignment:
| Q |
455 |
actttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
29274320 |
actttattttatcttttgctatagaaatagcttatacat |
29274358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 451 - 496
Target Start/End: Complemental strand, 781368 - 781323
Alignment:
| Q |
451 |
ttttactttattttatcttttgctatagaaatagtttctacattag |
496 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
781368 |
ttttactttattttatcttttattatagaaatagcttatacattag |
781323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 444 - 493
Target Start/End: Complemental strand, 7354194 - 7354145
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
7354194 |
aaaatagttcgattttattttatcttttgttatagaaatagtttatacat |
7354145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 444 - 484
Target Start/End: Original strand, 2027486 - 2027526
Alignment:
| Q |
444 |
aaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
2027486 |
aaaatagtttgactttattttatcttttgttataaaaatag |
2027526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 484
Target Start/End: Original strand, 9093628 - 9093676
Alignment:
| Q |
436 |
cttatacaaaaatagttttactttattttatcttttgctatagaaatag |
484 |
Q |
| |
|
||||||| |||| | ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
9093628 |
cttatacgaaaacaatttaactttattttatcttttgatatagaaatag |
9093676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 433 - 481
Target Start/End: Complemental strand, 10154222 - 10154174
Alignment:
| Q |
433 |
taacttatacaaaaatagttttactttattttatcttttgctatagaaa |
481 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
10154222 |
taacttatatgaaaacagtttgactttattttatctttttctatagaaa |
10154174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 443 - 487
Target Start/End: Complemental strand, 24774749 - 24774705
Alignment:
| Q |
443 |
aaaaatagttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||| ||||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
24774749 |
aaaaacagtttgactttattttatattttgttatagaaatagttt |
24774705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0590 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0590
Description:
Target: scaffold0590; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 1156 - 1203
Alignment:
| Q |
446 |
aatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
1156 |
aatagtttgactttattttatcttttgttatagaaatagcttatacat |
1203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 2819 - 2772
Alignment:
| Q |
446 |
aatagttttactttattttatcttttgctatagaaatagtttctacat |
493 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
2819 |
aatagtttgactttattttatcttttgttatagaaatagcttatacat |
2772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 449 - 487
Target Start/End: Original strand, 160057 - 160095
Alignment:
| Q |
449 |
agttttactttattttatcttttgctatagaaatagttt |
487 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
160057 |
agtttgactttattttatcttttgctataggaatagttt |
160095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University