View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_high_34 (Length: 321)
Name: NF19776_high_34
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 302
Target Start/End: Original strand, 47338619 - 47338907
Alignment:
| Q |
9 |
gaagaaaatg-taaaagaattgaggacaaggcttttgccaccgcaaacctacattacgagaaagagccagatggtgatggaggttctgcagtccagcttt |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47338619 |
gaagaaaatgctaaaagaattgaggacaaggcttttgccacggcaaacctacattacgagaaagagccagatggtgatggaggttctgcagtccagcttt |
47338718 |
T |
 |
| Q |
108 |
atgccaaagaatgcagtaagctcctcctagaactttttaaaatgggtcctagtaagaacagtgtcaaagaagcggtgatttctgannnnnnnnnnnnnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47338719 |
atgccaaagaatgcagtaagctcctcctagaacttcttaaaatgggtcctagtaagaacagtgtcaaagaagcggtgatttctga------tgctgctgc |
47338812 |
T |
 |
| Q |
208 |
nntccctcgtgaatttgtttttgatatatctaaaggccaaagggctttcattgaagcagaggaggctcatgaacttttgagtccactgaaggagc |
302 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47338813 |
tgtccctcgtgaatctgtttttgatatatctaaaggccaaagggctttcattgaagcagaggaggctcaagaacttttgagtccactgaaggagc |
47338907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University