View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_high_59 (Length: 227)
Name: NF19776_high_59
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 9876141 - 9876331
Alignment:
| Q |
16 |
atgaagttgtatttccaaatgaaaagttgtgatttatggcttctttggtctttatgtnnnnnnnnnnnnnnnattgtgcttgtatgatcttgtctcaa-g |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| | |
|
|
| T |
9876141 |
atgaagttgtatttccaaatgaaaaggtgtgatttatggcttctttggtctttatgttgtgtgtgtgt----attgtgcttgtatgatcttgtatcaaag |
9876236 |
T |
 |
| Q |
115 |
nnnnnnnnnngcagaagcagattgagtgattatattctaacactaccttgattaatgagttgtaattgcataggtttaggggttattgttgtatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9876237 |
aaaaaaaaaagcagaagcagattgagtgattatattctaacactaccttgattaatgagttgtaattgcataggtttaggggttattgttgtatt |
9876331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University