View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_high_62 (Length: 226)
Name: NF19776_high_62
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_high_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 91 - 220
Target Start/End: Complemental strand, 36274547 - 36274418
Alignment:
| Q |
91 |
acatttgattggatcgaattcannnnnnncaaatttgtcatataaactgaattaaaccgtacacgtgtgattttatctttgaaccagatgatatttttct |
190 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36274547 |
acatttggttggatcgaattcatttttttcaaatttgtcatataaactgaatcaaaccgtacacgtgtgattttatctttgaatcaaatgatatttttct |
36274448 |
T |
|
| Q |
191 |
tcaaaaccgcaactcaaacacccaagataa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36274447 |
tcaaaaccgcaactcaaacacccaagataa |
36274418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 32
Target Start/End: Complemental strand, 36274636 - 36274606
Alignment:
| Q |
2 |
aaatgtcctatgacacttgttaccatgatcc |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36274636 |
aaatgtcctatgacacttgttaccatgatcc |
36274606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University