View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_34 (Length: 343)
Name: NF19776_low_34
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 44729775 - 44730105
Alignment:
| Q |
1 |
gctaggcttccaccctttccctgataattgcctactcaaattcaaatactctgctctttcctccatcatttctggcaaaaactcacaaaaattaaacctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729775 |
gctaggcttccaccctttccctgataattgcctactcaaattcaaatactctgctctttcctccatcatttctggcaaaaactcacaaaaattaaacctc |
44729874 |
T |
 |
| Q |
101 |
tcttcttcatttatctgcaaactagtttcatattctccaatttcaactttctttttcttcaaaaaccttacaagccaaggaacaaagccttgagagctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729875 |
tcttcttcatttatctgcaaactagtttcaacttctccaatttcaactttctttttcttcaaaaaccttacaagccaaggaacaaagccttgagagctca |
44729974 |
T |
 |
| Q |
201 |
tgagataattattggtattaagagctgagttagcgatcgaaagaattcgacgacaatcttcggcgcttaatccgacaggcttccctggtttcattggaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729975 |
tgagataattattggtattaagagctgagttagcgatcgaaagaattcgactacaatcttcggcgcttaatccgacaggcttccctggtttcattggaac |
44730074 |
T |
 |
| Q |
301 |
catgacatattttttgttcatttctaggttc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44730075 |
catgacatattttttgttcatttctaggttc |
44730105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University