View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_49 (Length: 262)
Name: NF19776_low_49
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 21214914 - 21215167
Alignment:
| Q |
1 |
tggcacggtgattctggccgagcacaccaacttcaccggaaactttgctgaaatagctttgcaatgtttgcaaagactcccagcaaccaacacaaaattc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21214914 |
tggcatggtgattctggccgagcacaccaacttcactggaaacttcgttgaaatagctttgcaatgtttgcaaagactcccagcaaccaacacaaaattc |
21215013 |
T |
 |
| Q |
101 |
acttacaacaccgatggtcataccttcaactacctcgcccatgatggatttagtacttacctcttatc-tttttcttttacataatcactacaatgcgat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21215014 |
acttacaacaccgatggtcataccttcaactacctcgcccatgatggatttagtacttacctattatcttttttcttttacataatcactacaatgcgat |
21215113 |
T |
 |
| Q |
200 |
atatgaag--cagacactagatagatcaaatgcatttacatgtactggtttcat |
251 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21215114 |
atatgaggcacagacactagatagatcaaatgcatttacatgtactggtttcat |
21215167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University