View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_53 (Length: 250)
Name: NF19776_low_53
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_53 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 250
Target Start/End: Original strand, 38196377 - 38196624
Alignment:
| Q |
4 |
attctcgtaattgttctca-aatgtggactgcaatctgtgcactccaaagaaacacttttacccgttgcggaaatctaagcttccacattttctcccact |
102 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38196377 |
attctcgtaattgttctcacaatgtggacagcaatctgtgcactccaaagaaacacttttacccgctgcggaaatctaagcttccacattttctcccact |
38196476 |
T |
 |
| Q |
103 |
cccctggtactcggtactcttcattatcaattagagtctctatagcatatcgatatgctgatttcacagtataattacctctattattaaatttccaaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196477 |
cccctggtactcggtactcttcattatcaattagagtctccatagcatatcgatatgctgatttcacagtataattacctctattattaaatttccaaat |
38196576 |
T |
 |
| Q |
203 |
aagcttgtcttcctctgtagccattgtgattgtgagcttgcaaatctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196577 |
aagcttgtcttcctctgtagccattgtgattgtgagcttgcaaatctc |
38196624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University