View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19776_low_54 (Length: 248)

Name: NF19776_low_54
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19776_low_54
NF19776_low_54
[»] chr8 (1 HSPs)
chr8 (1-234)||(21182006-21182239)


Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 21182006 - 21182239
Alignment:
1 ttaagatccccagacacttccaataccaacctagaattgctaccgattgaaagtgtgtcatggtctcttttgagttgcaaatccactcgatttaaaacac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21182006 ttaagatccccagacacttccaataccaacctagaattgctaccgattgaaagtgtgtcatggtctcttttgagttgcaaatccactcgatttaaaacac 21182105  T
101 cctgaatagataaattggaattaccatcaacccataacacattagaacctttatttatggttagactcgccatgccaacatcatattggagagtatacgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21182106 cctgaatagataaattggaattaccatcaacccataacacattagaacctttatttatggttagactcgccatgccaacatcatattggagagtatacgg 21182205  T
201 tccaggagcagggtcttctgcagttgtccatgat 234  Q
    ||||||||||||||||||||||||||||||||||    
21182206 tccaggagcagggtcttctgcagttgtccatgat 21182239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University