View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_55 (Length: 243)
Name: NF19776_low_55
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 50 - 227
Target Start/End: Complemental strand, 8920834 - 8920657
Alignment:
| Q |
50 |
aatgattttgagtttgtcatttttgcataggaaattggaatatttctttcagcatattcttagagagggaaattaatgtgtcgaatggcttgcaaagacc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8920834 |
aatgattttgagtttgtcatttttgcataggaaattggaatatttctttcagcatattcttagagagggaaattaatgtgtcgaatggtttgcaaagact |
8920735 |
T |
 |
| Q |
150 |
gaagcttcatccagcaatatcttaaaactttggaatagttgtcctcggcaattcagtatcgtgttgatgactgatatt |
227 |
Q |
| |
|
||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8920734 |
gaaacttcatccagcgatatcttacaactttggaatagttgtcctcggcaattcagtatcgtgttgatgactgatatt |
8920657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 96 - 218
Target Start/End: Complemental strand, 34790310 - 34790188
Alignment:
| Q |
96 |
tttcagcatattcttagagagggaaattaatgtgtcgaatggcttgcaaagaccgaagcttcatccagcaatatcttaaaactttggaatagttgtcctc |
195 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||||||| | | |||| ||||||||||||||| ||| ||| ||||||| |||||||||||| |||| |
|
|
| T |
34790310 |
tttcagcatactcttagataaggaaattaatgtgtcaattaacttgtaaagaccgaagcttcctcccatgataccttaaaattttggaatagttttccta |
34790211 |
T |
 |
| Q |
196 |
ggcaattcagtatcgtgttgatg |
218 |
Q |
| |
|
|||| ||||| ||| ||||||| |
|
|
| T |
34790210 |
tgcaactcagtctcgcgttgatg |
34790188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University