View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19776_low_62 (Length: 227)

Name: NF19776_low_62
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19776_low_62
NF19776_low_62
[»] chr2 (1 HSPs)
chr2 (16-209)||(9876141-9876331)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 9876141 - 9876331
Alignment:
16 atgaagttgtatttccaaatgaaaagttgtgatttatggcttctttggtctttatgtnnnnnnnnnnnnnnnattgtgcttgtatgatcttgtctcaa-g 114  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||               ||||||||||||||||||||| |||| |    
9876141 atgaagttgtatttccaaatgaaaaggtgtgatttatggcttctttggtctttatgttgtgtgtgtgt----attgtgcttgtatgatcttgtatcaaag 9876236  T
115 nnnnnnnnnngcagaagcagattgagtgattatattctaacactaccttgattaatgagttgtaattgcataggtttaggggttattgttgtatt 209  Q
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9876237 aaaaaaaaaagcagaagcagattgagtgattatattctaacactaccttgattaatgagttgtaattgcataggtttaggggttattgttgtatt 9876331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University