View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_68 (Length: 220)
Name: NF19776_low_68
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 6072296 - 6072084
Alignment:
| Q |
1 |
tcatacacactacatactaaagttgaatccatgacaacatggttaaacgac---------ggtgtctcggatctttaggactttgttatcatatatatta |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
6072296 |
tcatacacactacatactaaagttgaatccatgacaacgtgcttaaacgaccaaattatcggtgtctcgagtctttagaactttgttatcatatatatta |
6072197 |
T |
 |
| Q |
92 |
ataatttgtgcatacaaatatgttttacattggccgtctctctaattgcttccctgttgaag--ctttgtatcctagaagactaaacatttctttagtct |
189 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
6072196 |
ataagttgtgcatacaaatatgttttacattggccgtctctctaattgcttccctgttgaagtactttatatcctagaagactaaacatttatttagtct |
6072097 |
T |
 |
| Q |
190 |
ccgcaatacataa |
202 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6072096 |
ccgcaatacataa |
6072084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 185
Target Start/End: Complemental strand, 6068128 - 6068097
Alignment:
| Q |
154 |
ctttgtatcctagaagactaaacatttcttta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6068128 |
ctttgtatcctagaagactaaacatttcttta |
6068097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University