View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19776_low_70 (Length: 218)
Name: NF19776_low_70
Description: NF19776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19776_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 37715189 - 37715008
Alignment:
| Q |
19 |
atagggggaagatttgaattgaaggaatcaaatttgtggtggattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37715189 |
atagggggaagatttgaattgaaggaatcaaatttgtggtggattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaag |
37715090 |
T |
 |
| Q |
119 |
atagattggtgacacctttgagcttgttccccttgagagggacttttcatccccttctacttcatgctaagggtcttgcttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37715089 |
atagattggtgacacctttgagcttgttccccttgagagggacttctcatccccttctacttcatgctaagggtcttacttg |
37715008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 23 - 169
Target Start/End: Complemental strand, 37708838 - 37708692
Alignment:
| Q |
23 |
ggggaagatttgaattgaaggaatcaaatttgtggtggattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaagatag |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37708838 |
ggggaagatatgaattgaaggaatcaaatttgtggtggattatttgttatggcccatgattgcaaaattgggacatcttccattgtccatattaagatag |
37708739 |
T |
 |
| Q |
123 |
attggtgacacctttgagcttgttccccttgagagggacttttcatc |
169 |
Q |
| |
|
||| ||||||| ||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37708738 |
attagtgacacttttgagcttgttccctttgagagggacttctcatc |
37708692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University