View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19777_high_12 (Length: 313)
Name: NF19777_high_12
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19777_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 130 - 302
Target Start/End: Complemental strand, 3139233 - 3139061
Alignment:
| Q |
130 |
aaatgcggataatgaacgtgggtacatgcactaaactagttactcacgttgataagggctcgagtacgagcaatttttacaaacataggtttaaggatga |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
3139233 |
aaatgcggataatgaacgtggatacatgcactaaactagttactcacgttgataagggctcgagtacgagcaatttttacaaacataggtctaaggataa |
3139134 |
T |
 |
| Q |
230 |
tcactatagtactttgtctaaaagttactcattgcgtcatcctaataaatatccaacaattgcaccctcctat |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3139133 |
tcactatagtactttgtctaaaggttactcattgcgtcatcctaataaatatccaacaattgcaccctcctat |
3139061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 3139397 - 3139341
Alignment:
| Q |
1 |
atattttgggtgtttttatttaactaaatacaatgatttgcaattacaagttgattt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3139397 |
atattttgggtgtttttatttaactaaatacaatgatttgcaattacaagttgattt |
3139341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University