View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19777_high_17 (Length: 242)
Name: NF19777_high_17
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19777_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 3139606 - 3139831
Alignment:
| Q |
1 |
ttttttggtgcctaatgaacttgtatacaattgtcttccataatcttcactcatataatataacactaatacattaaatactaacaatattaatattcat |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
3139606 |
tttttttgtgcctaatgaacttgaatacaattgtcatccataatcttcactcgtataatataacactaatacattaattactaacaatattaacattcat |
3139705 |
T |
 |
| Q |
101 |
ttgtnnnnnnnnnnnntagtaacattcattttgg-nnnnnnnnnnctcttaactcttcaatctgaaagcatatccac-atacaaattggggaccatggat |
198 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3139706 |
ttgt-aaaaaaaaaaatagtaacattcattttggaaaaaaaaaaactcttaactcttcaatctgaaagcatatccacaacacaaattggggaccatggat |
3139804 |
T |
 |
| Q |
199 |
agtggtggagaaaacaaagtagcatat |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3139805 |
agtggtggagaaaacaaagtagcatat |
3139831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University