View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19777_high_5 (Length: 438)
Name: NF19777_high_5
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19777_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 37 - 233
Target Start/End: Complemental strand, 12270388 - 12270192
Alignment:
| Q |
37 |
ttttagtatatatacgcttccatttcttggatctgacgagcagtgtgtcgatgataacgtttcttctttgtagcttgttgttcattattaatctcttgtt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12270388 |
ttttagtatatatacgcttccatttcttggatctgacgagcagtgtgtcgatgataacgtttcttctttgtagcttgttgttcattattaatctcttgtt |
12270289 |
T |
|
| Q |
137 |
catttcctgatttatcttcaacttgttcactacctgaaccactttgatccattatctcttctttacctctcaaaattccttcttcttctttctgttc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12270288 |
catttcctgatttatcttcaacttgttcactacctgaaccactttgatccattatctcttctttacctctcaaaattccttcttcttctttctgttc |
12270192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 345 - 422
Target Start/End: Complemental strand, 12270077 - 12270000
Alignment:
| Q |
345 |
gcatggttgacatgaagttgaagttagagttatggatcggagaagagaagagagattctgagtttactactacattcc |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12270077 |
gcatggttgacatgaagttgaagttagagttatggatcggagaagagaagagagattctgagtttactactacattcc |
12270000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University