View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19777_high_9 (Length: 334)

Name: NF19777_high_9
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19777_high_9
NF19777_high_9
[»] chr4 (2 HSPs)
chr4 (234-318)||(38411525-38411609)
chr4 (13-90)||(37715344-37715419)
[»] chr1 (1 HSPs)
chr1 (13-85)||(8265604-8265674)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 234 - 318
Target Start/End: Complemental strand, 38411609 - 38411525
Alignment:
Q  234 ctcgcagtcggaacggcattaacatcttgtcttgctaagaaatgggattgatcaggatatgttgttatttatagaaggatgaaag 318  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38411609 ctcgcagtcggaacggcattaacatcttgtcttgctaagaaatgggattgatcaggatatgttgttatttatagaaggatgaaag 38411525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 90
Target Start/End: Complemental strand, 37715419 - 37715344
Alignment:
Q  13 aatattgataataggttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtatatata 90  Q
    ||||||||||||| |||||||||||||||||||  |||||||||||||||||||||||||||||| | ||||||||||    
T  37715419 aatattgataataagttgattgttcaacgattt--cagaacatgtaattgggtaaatgacaattgcaaagtatatata 37715344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 13 - 85
Target Start/End: Complemental strand, 8265674 - 8265604
Alignment:
Q  13 aatattgataataggttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtat 85  Q
    |||||||||||||||||||||||||||| |  |||||||||||||||   |||||||||||||||| ||||||    
T  8265674 aatattgataataggttgattgttcaacaa--tttcagaacatgtaaaatggtaaatgacaattgtggagtat 8265604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University