View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19777_low_19 (Length: 254)
Name: NF19777_low_19
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19777_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 231
Target Start/End: Complemental strand, 48357594 - 48357385
Alignment:
| Q |
22 |
atgttgctgggcttcaagtcacggtgaataattttgggcttttgctcatgaagatactgcatagcttgggctatctctatgacccttgttagtctttctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357594 |
atgttgctgggcttcaagtcacggtgaataattttgggcttttgctcatgaagatactgcatagcttgggctatctctatgacccttgttagtctttctt |
48357495 |
T |
 |
| Q |
122 |
tgaaaggaggaagtggcacaattctatctctgcgtcttttgccaggaccataaagccactccttaagtgtggtgcttagatattcagtaacaacccaagc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48357494 |
tgaaaggaggaagtggcacaattctatctctgcgtcttttgccaggaccataaagccactccttaagtgtggtgcttagatattcagtaaccacccaagc |
48357395 |
T |
 |
| Q |
222 |
atgattagga |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
48357394 |
atgattagga |
48357385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University