View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19777_low_22 (Length: 213)
Name: NF19777_low_22
Description: NF19777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19777_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 22443590 - 22443397
Alignment:
| Q |
8 |
tgtcgaaaaatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443590 |
tgtcgaaccatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
22443491 |
T |
|
| Q |
108 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgtttttattttaagttcttccgaagacacttttgatgat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
22443490 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgttttttttttaag---ttccgaagacacttttgctgat |
22443397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University