View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19778_low_5 (Length: 205)
Name: NF19778_low_5
Description: NF19778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19778_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 31245909 - 31245740
Alignment:
| Q |
24 |
tacgtaaccggagtagggggtgaatattcaatagaggaattttcatgcacaatcatgtttgatatatcc-ttttatgatttttccttcgtaagctctcaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
31245909 |
tacgtaaccggagtagggggtgaatattcaatagaggaattttcatgcacaatcatgtttgatatatcccttttatgatttttccttcgtaagctctcga |
31245810 |
T |
 |
| Q |
123 |
aatgtttccctcttggaagcaagcaaaatacggcacaagatcattagcatgtgaattcatgataaatatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245809 |
aatgtttccctcttggaagcaagcaaaatacggcacaagatcattagcatgtgaattcatgataaatatg |
31245740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 77 - 141
Target Start/End: Complemental strand, 31220996 - 31220934
Alignment:
| Q |
77 |
catgtttgatatatccttttatgatttttccttcgtaagctctcaaaatgtttccctcttggaag |
141 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
31220996 |
catgtttgatata--cttttatgacttttccttcgtaagctctcagattgtttccctattggaag |
31220934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University