View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1977_high_12 (Length: 229)
Name: NF1977_high_12
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1977_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 33203950 - 33203752
Alignment:
| Q |
16 |
gaagcaacggcgaaccattaacagctttttcagcaatctctttcataagagaagcgtattgaattccaagaccaatttcaaaatcaacaacgtgcatgta |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203950 |
gaagcaacggcgaaccgttaacagctttttcagcaatctctttcataagagaagcgtattgaattccaagaccaatttcaaaatcaacaacgtgcatgta |
33203851 |
T |
|
| Q |
116 |
taacgatccatgcaacgcttcgagtaacgcttggttggttgtgaaaatagaaaacattggaataggtgaaattccagaaaaggccttgaaggttcttat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33203850 |
taacgatccatgcaacgcttcgagtaacgcttggttcgttgtgaaaatagaaaacattggaataggtgaaattccagaaaaggccttgaaggttcttat |
33203752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University