View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1977_high_13 (Length: 222)
Name: NF1977_high_13
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1977_high_13 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0194 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 3 - 209
Target Start/End: Original strand, 20626 - 20831
Alignment:
| Q |
3 |
gagctttgaaatttggcatcaactttatttgagatgacattcttttttggtatttgaagctgacgagatccaagaactgtggttggagtatgaaaacaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20626 |
gagctttgaaatttggcatcaactttatttgagatgacattcttttttggtatttgaagctgacgagatccaagaactgtggttggagtatgaaaacaat |
20725 |
T |
|
| Q |
103 |
tcttctttagaggctaatgttgttaaagattttgacaaggtatgcatatgctacctagtacctaatatagaaggatctgttgtgtctttcttgctccttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
20726 |
tcttctttagaggctaatgttgttaaagattttgacaaggtatgcatatgctacctagtacctaataca-aaggaactgttgtgtctttcttgctccttc |
20824 |
T |
|
| Q |
203 |
attaaac |
209 |
Q |
| |
|
||||||| |
|
|
| T |
20825 |
attaaac |
20831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University