View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1977_low_1 (Length: 443)
Name: NF1977_low_1
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1977_low_1 |
 | |
|
| [»] scaffold0927 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 7e-53; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 16 - 125
Target Start/End: Original strand, 28565529 - 28565638
Alignment:
| Q |
16 |
cccttttctgctatgattggcaattaggcagatgccttaagcacttgcggttatgagtctgttctgttcacaattttatttgtgccttttccttatcccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28565529 |
cccttttctgctatgattggcaattaggcagatgccttaagcacttgcggttatgagtctgttctgttcacaattttatttgtgccttttccttatcccc |
28565628 |
T |
|
| Q |
116 |
ccttcttatt |
125 |
Q |
| |
|
||| |||||| |
|
|
| T |
28565629 |
cctccttatt |
28565638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 178 - 313
Target Start/End: Original strand, 28565635 - 28565770
Alignment:
| Q |
178 |
tattgttgatggatcttagtgatcttatatagtaacgcatcttcagcttattactagtcccctggtttaactacttcattcttttatggtttggttagag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
28565635 |
tattgttgatggatcttagtgatcttatatagtaatgcatcttcagcttattactagtcccctgattcaataacttcattcttttatggtttggttagag |
28565734 |
T |
|
| Q |
278 |
gtaagctttcaacttgttgaatatattaacagagct |
313 |
Q |
| |
|
||||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
28565735 |
gtaagatttcaactttttgtaaatattaacagagct |
28565770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 265 - 370
Target Start/End: Original strand, 28583750 - 28583855
Alignment:
| Q |
265 |
ggtttggttagaggtaagctttcaacttgttgaatatattaacagagctcaaggnnnnnnnt-ttcagcatgcaattttcagaactagacgcttaatgtt |
363 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28583750 |
ggtttggttag-ggtaagcttttaacttgttgaaaatattaacagagctagaggaacgaaaacttcagcatgcaattttcagaactagacacttaatgtt |
28583848 |
T |
|
| Q |
364 |
attttat |
370 |
Q |
| |
|
||||||| |
|
|
| T |
28583849 |
attttat |
28583855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 223 - 370
Target Start/End: Original strand, 28577313 - 28577460
Alignment:
| Q |
223 |
gcttattactagtcccctggtttaactacttcattcttttatggtttggttagaggtaagctttcaacttgttgaatatattaacagagct-caaggnnn |
321 |
Q |
| |
|
|||||| || || |||||| ||||| ||||||||| |||||||||||||||| |||||||||| |||||||| || |||||||||||||| || |
|
|
| T |
28577313 |
gcttatcaccaggcccctgatttaataacttcattcctttatggtttggttag-ggtaagcttttaacttgtttaaaatattaacagagctagaaaaaca |
28577411 |
T |
|
| Q |
322 |
nnnntttcagcatgcaattttcagaactagacgcttaatgttattttat |
370 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
28577412 |
aaaatttcagcataaaaatttcagaactagacccttaatgttattttat |
28577460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0927 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0927
Description:
Target: scaffold0927; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 237 - 308
Target Start/End: Complemental strand, 1116 - 1046
Alignment:
| Q |
237 |
ccctggtttaactacttcattcttttatggtttggttagaggtaagctttcaacttgttgaatatattaaca |
308 |
Q |
| |
|
||||| ||||| ||||||||||||||| |||||||||| ||| ||||| ||||||||||| ||||||||| |
|
|
| T |
1116 |
ccctgatttaataacttcattcttttatagtttggttag-cgtacgcttttaacttgttgaaaatattaaca |
1046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University