View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1977_low_11 (Length: 249)
Name: NF1977_low_11
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1977_low_11 |
 |  |
|
| [»] scaffold0194 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 59 - 244
Target Start/End: Original strand, 20896 - 21073
Alignment:
| Q |
59 |
ttatcatcttttttgtgaaaccaacgaaaatctattattgtagtcttgtagatgtatctgaaattcggaacattaaaaacttggtttgattttgaggata |
158 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
20896 |
ttatcatcttttttatgaaaccaacgaaaatctattatcgtag--------atgtatctgaaatttggaacattaaaaaattggtttgattttgaggata |
20987 |
T |
 |
| Q |
159 |
atatgaaggtcaagttttcagtactatcacctcttaaaggtgtcctgtcctcaaggcagcaattaggataatggccctatgctact |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
20988 |
atatgaaggtcaagttttcagtactatcacctctaaaaggtgtcctgtcctcaaggcagtaattaggataatggcccgatgctact |
21073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 20824 - 20873
Alignment:
| Q |
9 |
cattaaacctttctctgtttactatcttggactc--agtaaattgcacat |
56 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
20824 |
cattaaacctttatctgtttactatcttcgactcaaagtaaattgcacat |
20873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University