View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1977_low_11 (Length: 249)

Name: NF1977_low_11
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1977_low_11
NF1977_low_11
[»] scaffold0194 (2 HSPs)
scaffold0194 (59-244)||(20896-21073)
scaffold0194 (9-56)||(20824-20873)


Alignment Details
Target: scaffold0194 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 59 - 244
Target Start/End: Original strand, 20896 - 21073
Alignment:
59 ttatcatcttttttgtgaaaccaacgaaaatctattattgtagtcttgtagatgtatctgaaattcggaacattaaaaacttggtttgattttgaggata 158  Q
    |||||||||||||| ||||||||||||||||||||||| ||||        |||||||||||||| ||||||||||||| ||||||||||||||||||||    
20896 ttatcatcttttttatgaaaccaacgaaaatctattatcgtag--------atgtatctgaaatttggaacattaaaaaattggtttgattttgaggata 20987  T
159 atatgaaggtcaagttttcagtactatcacctcttaaaggtgtcctgtcctcaaggcagcaattaggataatggccctatgctact 244  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||    
20988 atatgaaggtcaagttttcagtactatcacctctaaaaggtgtcctgtcctcaaggcagtaattaggataatggcccgatgctact 21073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 20824 - 20873
Alignment:
9 cattaaacctttctctgtttactatcttggactc--agtaaattgcacat 56  Q
    |||||||||||| ||||||||||||||| |||||  ||||||||||||||    
20824 cattaaacctttatctgtttactatcttcgactcaaagtaaattgcacat 20873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University