View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1977_low_15 (Length: 219)
Name: NF1977_low_15
Description: NF1977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1977_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 26 - 203
Target Start/End: Complemental strand, 8350530 - 8350353
Alignment:
| Q |
26 |
tccaacgattaggatcaacaaaactaccacctatattcctcccatgacaaataccattcataaaagcacaaagagtactaaacacaagtaatattaaagg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||| | |
|
|
| T |
8350530 |
tccaacgattaggatcaacaaaactaccacctatattcctcccatgacaaataccattcataaaaacacaaagagtactaaacacaagcaatgctaagtg |
8350431 |
T |
 |
| Q |
126 |
caaatactttgcattagcagcagtactagcacccatactgattttagacaacttactttgcttgacgttcttggttgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8350430 |
gaaatactttgcattagcagcagtactagcacccataatgattttagacaacttactttgcttgacgttcttggttgt |
8350353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University