View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19780_low_4 (Length: 223)
Name: NF19780_low_4
Description: NF19780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19780_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 39 - 138
Target Start/End: Original strand, 2100895 - 2100994
Alignment:
| Q |
39 |
atatttgatttacgtacaaaaatattcaatgtctaatatcctgtaaattgtagcatacaatatacaaaccattcaatcattctagtcttcaatgattgaa |
138 |
Q |
| |
|
||||||| ||||| |||||||||||| || |||| |||| ||| ||||||||||||||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
2100895 |
atatttggtttacatacaaaaatattgaacgtctgatatgctggaaattgtagcatacaatatacaaacgattcaatcattgttgtcttcaatgattgaa |
2100994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 2101065 - 2101110
Alignment:
| Q |
140 |
gtgtagaaggattagtctatactttagaatataatgtctgatacgt |
185 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2101065 |
gtgtagaaggattggtctatactttagaatataatgtctgatacgt |
2101110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University