View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_high_45 (Length: 307)
Name: NF19782_high_45
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 50774886 - 50774648
Alignment:
| Q |
2 |
ggatgtcgaagaaaatacttctcacgcttgttggatttcgtacggccaacatacttttagctgagatatataaacttgtttaaccactttcagtccaatc |
101 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50774886 |
ggatgtcgacggaaatacttctcacgcttgttggatttcgtacggccaacatatttttagctg-gatatataaacttgtttaaccactttcagtccaatc |
50774788 |
T |
 |
| Q |
102 |
aatatgcttttatgggcgcaaatgatagtttcagcactcaaatggagaatatgatcaaaattgattaaaaaatgattttagttttgtacaataattgagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50774787 |
aatatgcttttatgggcgcaaatgatggtttcagcactcaaatggagaatatgatcaaaattgattaaaaagtgattttagttttgtacaataattgagt |
50774688 |
T |
 |
| Q |
202 |
tggttttcaaaattatttaattttatactatgatgatgag |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50774687 |
tggttttcaaaattatttagttttatactatgatgatgag |
50774648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 238 - 291
Target Start/End: Complemental strand, 50774586 - 50774533
Alignment:
| Q |
238 |
tgagctaagctcacgaggacgttgatgatgagtctgattgacatgtaacatagt |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50774586 |
tgagctaagctcacgaggacgatgatgatgagtctgattgacatgtaacatagt |
50774533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University