View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_high_59 (Length: 257)
Name: NF19782_high_59
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_high_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 33303096 - 33302982
Alignment:
| Q |
20 |
ctttaatctgcctttctagatcagccttcttttccaagagtgcttctaactttgcattcactttttcaagcttctgtttcagcttattaggatcattggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33303096 |
ctttaatctgcctttctagatcagccttcttttccaagagtgcttctaactttgcattcactttttcaagcttctgtttcagcttactaggatcattggt |
33302997 |
T |
|
| Q |
120 |
cttatcctttccaga |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33302996 |
cttatcctttccaga |
33302982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 244
Target Start/End: Complemental strand, 33302911 - 33302872
Alignment:
| Q |
205 |
atatcaatatcccttacagatacttttccctcttctttct |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33302911 |
atatcaatatcccttacagatactttaccctcttctttct |
33302872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University