View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19782_high_59 (Length: 257)

Name: NF19782_high_59
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19782_high_59
NF19782_high_59
[»] chr7 (2 HSPs)
chr7 (20-134)||(33302982-33303096)
chr7 (205-244)||(33302872-33302911)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 33303096 - 33302982
Alignment:
20 ctttaatctgcctttctagatcagccttcttttccaagagtgcttctaactttgcattcactttttcaagcttctgtttcagcttattaggatcattggt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
33303096 ctttaatctgcctttctagatcagccttcttttccaagagtgcttctaactttgcattcactttttcaagcttctgtttcagcttactaggatcattggt 33302997  T
120 cttatcctttccaga 134  Q
    |||||||||||||||    
33302996 cttatcctttccaga 33302982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 244
Target Start/End: Complemental strand, 33302911 - 33302872
Alignment:
205 atatcaatatcccttacagatacttttccctcttctttct 244  Q
    |||||||||||||||||||||||||| |||||||||||||    
33302911 atatcaatatcccttacagatactttaccctcttctttct 33302872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University