View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_high_86 (Length: 223)
Name: NF19782_high_86
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_high_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 160
Target Start/End: Complemental strand, 44587063 - 44586917
Alignment:
| Q |
14 |
gcaaaaccgaaagtggagcttcacttgataattattaaaaacaaaaccaattcctgatattatatttcaaaagttcatgtgttattgttcaactcaaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
44587063 |
gcaaaaccgaaagtggagcttcacttgataattattaaaaacaaaaccaattcctgatattatatttcaaaagttcatgtgttattgttcaacttaatat |
44586964 |
T |
 |
| Q |
114 |
aagtcgattggaaaatagcttttgatagagagaaaagctgatcgaaa |
160 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44586963 |
aagtcgattggaaaaaagcttttgatagagagaaaagctgatcgaaa |
44586917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 44586892 - 44586838
Alignment:
| Q |
152 |
tgatcgaaagttatgttgcaataaatcaaaactgaagggaatgtagagctatttt |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44586892 |
tgatcgaaagttacgttgcaataaatcaaaactgaagggaatgtagagctatttt |
44586838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University