View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_high_88 (Length: 212)
Name: NF19782_high_88
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_high_88 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 21558344 - 21558156
Alignment:
| Q |
11 |
agaagcaaagggtcttcctattgaagaggttgagaacatgttggaaagaagaaccttgaattttaagttttggcaaaggaattctggttctgatcaagca |
110 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21558344 |
agaaacaaagggacttcctattgaagaggttgagaacatgttggaaagaagaaccttgaattttaagttttggcaaaggaattctggctctgatcaagca |
21558245 |
T |
|
| Q |
111 |
ttgaatcaaaagaatgtgtcattttgagttaattagataatagtatcaaatgagttagatgttgcatgctagattaggtttatagattt |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21558244 |
ttgactcaaaagaatgtgtcattttgagttaattagacaatagcatcaaatgagttagatgttgcatgctagattaggtttatagattt |
21558156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University