View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_18 (Length: 433)
Name: NF19782_low_18
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 262 - 393
Target Start/End: Complemental strand, 26225756 - 26225615
Alignment:
| Q |
262 |
gcaacagcgaatacgattatggttttgattatgatgattatgaaagatgttt-----attgtttat-----tgttaatagtagcaggaatgacgtcagtt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| | ||| | ||| || |||||||||||||||||||||||||| |
|
|
| T |
26225756 |
gcaacagcgaatacgattatggttttgattatgatgattatgaaggatgtatctatgattttatatgaaagtgataatagtagcaggaatgacgtcagtt |
26225657 |
T |
|
| Q |
352 |
catgttaaggtaacaattgcttttgattatatatcctgagtt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225656 |
catgttaaggtaacaattgcttttgattatatatcctgagtt |
26225615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 120 - 177
Target Start/End: Complemental strand, 26225892 - 26225835
Alignment:
| Q |
120 |
gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225892 |
gacaacagtggtaatggaggtgttggttatgtgtatgagtataacaacaatgacggta |
26225835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 26226023 - 26225980
Alignment:
| Q |
1 |
atgattatgatgtcgacgatggtggtgatgaagttgttggttacgtg |
47 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26226023 |
atgattataatgtcgacgatggtgg---tgaagttgttggttacgtg |
26225980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University