View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_30 (Length: 370)
Name: NF19782_low_30
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 41083134 - 41082875
Alignment:
| Q |
17 |
acctattaacatttgttcagaccatatcactttcagtatgagactcttaacatacatcgagtagttttcaatctttctagtttcatacgttttttagttt |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||||||||||||||| | |||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
41083134 |
acctataaacatttgttcagaccatatcactatcagtgtgagactcttaacatacgtagagtagttttcaatctttctagtttcattcgctttttagttt |
41083035 |
T |
|
| Q |
117 |
ctgcacaaaaataatagacgattaagcgtttt-----------ttctatcgtgattaacattttagcttaagtcaatgaatataatgaattgttaaacat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41083034 |
gtgcacaaaaataatagacgattaagcgttttgtcatttttttttctatcgtgattaacattttagcttaagtcaatgaagataatgaattgttaaacat |
41082935 |
T |
|
| Q |
206 |
ttttcataaatatattggatgatttagcatcttttagtttttgccttgttaactggttaa |
265 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41082934 |
tttccataaatatattcgatgatttagcatcttttagtttttgccttgttaactggttaa |
41082875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 201 - 370
Target Start/End: Complemental strand, 41082876 - 41082703
Alignment:
| Q |
201 |
aacatttttcataaatatattggatgatttagcatcttttagtttttgccttgttaactggttaagctttgttcataatcttttttgaaaatatttgtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41082876 |
aacatttttcataaatatattggatgatttagcatcttttagtttttgccttgttaactggttaagctttgttcataatcttttttgaaaatatttgtta |
41082777 |
T |
|
| Q |
301 |
attcttagttaagttagtcatcagtgtaatctttttcatttc----atatggactgtatgtataaatagagtct |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41082776 |
attcttagttaagttagtcatcagtgtaatctttttcatttcatatatatggactgtatgtataaatagagtct |
41082703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University