View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_42 (Length: 319)
Name: NF19782_low_42
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 9 - 264
Target Start/End: Original strand, 16916606 - 16916861
Alignment:
| Q |
9 |
tgatgcttttgtggcgaagttttgggagaattggagaggtagagcgtgggaggagtcggagaaggttgccagttcgacctcgaatgcggtggccggggga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
16916606 |
tgatgcttttgtggcgaagttttgggagaattggagaggtagagcgtgggaggagtcggagaaggttgccagttcgagctcgaatgcggtggccggggca |
16916705 |
T |
 |
| Q |
109 |
ggttcggcatcgagtgggagcggtatttattcgagtgatgggacggtgaggatggtgggagtttcggggattttaaggaaagagcaggaaatgtgggaga |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16916706 |
ggttcggcatcgagtgggagcgggatttattcgagtgatgggacggtgaggatggtgggagtttcggggattttaaggaaagagcaggaaatgtgggaga |
16916805 |
T |
 |
| Q |
209 |
gtactgataagagtttgcaggatgcttttcaggatttgaatgctcttatggtaatg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16916806 |
gtactgataagagtttgcaggatgcttttcaggatttgaatgctcttatggtaatg |
16916861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University