View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_52 (Length: 287)
Name: NF19782_low_52
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 45552387 - 45552646
Alignment:
| Q |
18 |
aggattaggagagaaaaggagaagactttgagaatagaggaaggagtaaatggatgagtgagtaatagacattgcataatcaaaattcttcatcattaaa |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45552387 |
aggattaggagagaaagggagaagactttgagaattgaggaaggagtaaatggaagagtgagtaatagacattgcataatcataattcttcatcattaaa |
45552486 |
T |
 |
| Q |
118 |
gtattcaatatagaagaatgctttaaatgcaacgggctagtacttcagagaattttgaataatttttcacaagtactgtcaagtatcatcacctatcttc |
217 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45552487 |
gtcttaaatatagaagaatgctttaaatgcaacgggctagtacttcagagaattttgaataatttttcacaagtacggtcaagtatcatcacctatcttc |
45552586 |
T |
 |
| Q |
218 |
cataatattaaaccaaaaaattgagtttcacctgtctttccttttctcttctcccctatg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45552587 |
cataatattaaaccaaaaaattgagtttcacctgtctttccttttttcttctcccctatg |
45552646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University