View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_57 (Length: 260)
Name: NF19782_low_57
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 12961409 - 12961166
Alignment:
| Q |
1 |
aaattgggaaataatcaaaatgagacttcactcnnnnnnnnttatatgcaattatatagttttaatgtatatattagtgtttcttatgatgttttagatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12961409 |
aaattgggaaataatcaaaatgagacttcactcaaaaaaaattatatgaaattatatagttttaatgtatatattagtgtttcttatgatgttttagatg |
12961310 |
T |
|
| Q |
101 |
gtgctactcagaagtttctgatatttggatattgtagtggacaatgttacatgaagtgtgaagactgctagtagcctaatttggatgaaccatgataatt |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12961309 |
gtgctactcagaagtttctaatagttggatattgtattggacaatgtcacatgaagtgtgaagactgctagtagcctaatttggatgaaccatgataatt |
12961210 |
T |
|
| Q |
201 |
tttgtgtgtgatattcttacccttaatagtttactatttatttt |
244 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12961209 |
tttgtatgtgatattcttacccttaatagtttactatttgtttt |
12961166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University