View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_63 (Length: 255)
Name: NF19782_low_63
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 42463011 - 42462870
Alignment:
| Q |
11 |
agcaaaggtaaatgtataaaaaatgggaaggacaatgaaattgcttttattctatcgacataaagcatgccgccttgtctcgtattatgataatatgcca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42463011 |
agcaaaggtaaatgtataaaaaatgggaaggacaatgaaattgattttattctgtcgacataaagcatgcc---ttgtctcgtattatgataatatgcca |
42462915 |
T |
 |
| Q |
111 |
ccgaaacaccctaagcaaacattttcgggtttctggaactaaaaa |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42462914 |
ccgaaacaccctacgcaaacattttcgggtttctggaactaaaaa |
42462870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 42462866 - 42462824
Alignment:
| Q |
194 |
caataagtctgttggagattgtatgcacactcttcctagcttg |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42462866 |
caattagtctgttggagattgtatgcacactcttcctagcttg |
42462824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University