View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_64 (Length: 253)
Name: NF19782_low_64
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 33855095 - 33854862
Alignment:
| Q |
4 |
tgggtagataattcttgaagaacccagaatgtaatagcttagtcatactatcataaagcacattgttaaatctattaaaattttgatcttatgagctttg |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33855095 |
tgggtaaataattcttgaagaacccagaatgtaatagcttagtcatactatcataaagcacattgttaaatctattgaa-ttttgatcttatgagctttg |
33854997 |
T |
 |
| Q |
104 |
atcattatcagtgnnnnnnnnnnnnnnnnnnnnngtgatttaggaaaagaagaaatctcgttcaagatcaaataggtaagtttttaattgtgagagttat |
203 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33854996 |
at---tatcagtgtttaattttttattttattttgtgatttaggaaaagaagaaatctcgttcaagatcaaataggtaagtttttaattgt--gagttat |
33854902 |
T |
 |
| Q |
204 |
tctttgacattattgagatatcagcaaatacacgttgttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33854901 |
tctttgacattattgagatatcagcaaatacacgttgttt |
33854862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University