View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_68 (Length: 248)
Name: NF19782_low_68
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 47 - 239
Target Start/End: Original strand, 54777 - 54967
Alignment:
| Q |
47 |
ctgcatgcacagttgcttatttatgactatacatagatgcgggttaatttgtcttatacatgtctcatattatacttaattaggatacgatcaaacatca |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54777 |
ctgcatgcacagttgcttatttatgactatacatagatgtgggttaatttgtcttatacatgtctcatattatacttaattaggatacgatcaaacatca |
54876 |
T |
|
| Q |
147 |
aagnnnnnnnnnnnngattaaggcactaagcttcaaaagtaagatacccctaattatgacattttcttattacaattctttctttgtagaata |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54877 |
aag--tatatatatagattaaggcactaagcttcaaaagtaagatacccctaattatgacattttcttattacaattctttctttgtagaata |
54967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University