View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_70 (Length: 247)
Name: NF19782_low_70
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 232
Target Start/End: Original strand, 961908 - 962133
Alignment:
| Q |
9 |
atgaaagaaaacatacttaaaggaacaaaaatgtaatttaactattaatatgaaatgaaagaagtattattaaaccagtcttctaaaatatacttatatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
961908 |
atgaaagaaaacatacttaaaggaacaaaaatgtaatttaactattaatatgaaacgaaagaagtattattaaaccagtcttctaaaatatacttatatt |
962007 |
T |
 |
| Q |
109 |
atattattatcaaattctgaattatcta----cgtgcatgcatgcattaactttactctcaatttgcatgcacctggaattagaagcatttatatcctta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
962008 |
atattattatcaaattctgaattatctatgtgcatgcatgcatgcattaactttactctcaatttgcatgtacctggaattagaaggatt--tatcctta |
962105 |
T |
 |
| Q |
205 |
catttcaaatttcaaatatagtacattc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
962106 |
catttcaaatttcaaatatagtacattc |
962133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University