View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_86 (Length: 226)
Name: NF19782_low_86
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_86 |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 3962 - 3765
Alignment:
| Q |
19 |
agagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgacacgaaataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3962 |
agagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgacacgaaataa |
3863 |
T |
 |
| Q |
119 |
aagattcggctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatatgtcacctgtgtaaaaccttcttctctct |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
3862 |
aagattcagctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatttgtcacctgtgtaaaaccttcttttctct |
3765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University