View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19782_low_87 (Length: 224)
Name: NF19782_low_87
Description: NF19782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19782_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 38438171 - 38438347
Alignment:
| Q |
13 |
aagaaaattataagataatttttcatgtgaaggttttattacctaatcgtggatatttttaagtttatttcaaatgaacggatgatagataataatgtat |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38438171 |
aagaatattataagataatttttcatgtgaaggttttattaccta-tcgtggatatttttaagtttatttcaaatgaacggatgatagataataatgtat |
38438269 |
T |
 |
| Q |
113 |
actcgagtttggaataatgtcattaatattgtgacatgtgcatgtaat--gagttagcaaatatgaaacaactctaag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
38438270 |
actcgagtttggaataatgtcattaatattgagacatgtgcatgtaatgagagttggcaaatatgaaacaactctaag |
38438347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University